Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AF092123

[Submit comment/correction]

Sequence	AF092123
Contig	Ta.9226.1.S1_at
Subsequence	AF092123_1.cds 1 360
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC296577
NCBI UniGene	Ta.9226
Data at Gramene	Gramene-Protein Q9SQG8
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Pathogenesis-related protein 4'
Species	Triticum aestivum
Developmental Stage	7 day-old seedlings
Data Source	genbank Release 135, Apr 15 2003
Title	Triticum aestivum pathogenesis-related protein 4 (PR4) mRNA, partial cds.
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Gene: PR4
EMBL Feature	feature_gene 1 360 Location: <1..>360
DNA	gcaacgtatcattactaccggccagcgcagaataactgggacctgggcgc gcccgcggtgagcgcctactgcgcaacctgggacgccagcaagccgctgt cgtggcggtccaagtacgggtggacggcgttctgcggccccgccggcgcc cacgggcaggcggcgtgcggcaagtgcctccgggtgacgaacccggcgac gggggcgcaggtgacggcgaggatcgtggaccagtgcgccaacggcgggc tggacctggactgggacaccgtcttcaccaagatcgacaccaacgggatc gggtaccagcaaggccatcttaatgtgaactatcagtttgtcgactgccg ggacaataat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.