Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_rep_c85921_842

[Submit comment/correction]

Sequence	RAC875_rep_c85921_842
Contig	2AL_6385975
Species	Triticum aestivum
Probe	RAC875_rep_c85921_842
DNA	tcgcgctccctcatgagcaagatgtccttgagctcctccacctcatcctc Rtagaaggcgcagcgctcatcagaggtgcggcgctgctgccgcacctcca t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.