Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig2800_905

[Submit comment/correction]

Sequence	RFL_Contig2800_905
Contig	6AL_5833052
Species	Triticum aestivum
Probe	RFL_Contig2800_905
DNA	acctggtggatctcatctacgagtccctgcggaacccggcctacacgggc Rtcatcaacggcacggcgcccaacccggtgcggctgtcggagctgtgcga c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.