Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c21491_30637789

[Submit comment/correction]

Sequence	wsnp_Ex_c21491_30637789
Contig	3DL_6929245
Species	Triticum aestivum
Probe	wsnp_Ex_c21491_30637789
DNA	ttccttcggagacgcatcttctagcattccagaagatcagctcagaatga ttgacaacatcaactccttgatgtcggagttagcagtggagagagaagag YTAATGCGAGCACTGAGAATCGAGTCATCCAACTGCTCCAAGCTGAAGGA GCTGAACAGGGATCTAACACAAAAGCTGGAGACTCAGACACACAGACTTG A

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.