Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ku_c23598_33524385

[Submit comment/correction]

Sequence	wsnp_Ku_c23598_33524385
Contig	2AS_2802748
Species	Triticum aestivum
Probe	wsnp_Ku_c23598_33524385
DNA	ctccaagctactgcggccgcgacgacctcgagaccctgatggcctccgac tcacgcagccgactgggtgaggatctcggagctgctgctcggcaaagtcc YGGAAGGGTTCACCTTCGCGCCCAAGCACAAGTCTAACTCGTACGACCGC GCTGAGAACGGCTAAAAGACTGCCGCGTGATGGTTATTCGGCAGTTTATA T

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.