Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AF218305

[Submit comment/correction]

Sequence	AF218305
Subsequence	AF218305_1.cds 47 784
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC156716
NCBI UniGene	Hv.3889
Data at Gramene	Gramene-Protein Q9SDM1
DB Remark	Locus Source: Hordeum vulgare UniGene title 'Light-harvesting complex I'
Species	Hordeum vulgare
Tissue	leaf
Developmental Stage	greening seedlings
Data Source	genbank Release 135, Apr 15 2003
Title	Hordeum vulgare chlorophyll a/b binding protein precursor (lhca1) mRNA, complete cds; nuclear gene for chloroplast product.
Gene Product	chlorophyll a/b binding protein
Remark	DB_xref: taxon:4513 Feature: source: mol_type = 'mRNA'; Gene: lhca1
EMBL Feature	mat_peptide 179 781 Location: 179..781 transit_peptide 47 178 Location: 47..178 feature_gene 1 784 Location: 1..784
DNA	ggccgcgcagcaaggagcagccagcatcgagagagcagcaatggctatgg cgtcgtcaagcgggctcaggagctgcagcgccgtgggcgtgccgagcctg ctggcgccttcgtcccggtccggccgctccggactgccgttctgcgccta cgccaccacctccggccgcgtcaccatgtccgccgagtggttccccggcc agccccgccccgcccatctggacggctcctcgccaggggacttcgggttc gaccccctgggcctcgccaccgtgccggagaacttcgagcggttcaagga gtccgagatctaccactgccgctgggccatgctctgcgtgccaggggtgc tggtgccggaggcgctggggctgggcaactgggtgaaggcgcaggagtgg gcggcgctcccagacgggcaggcgacgtacctgggcaacccggtgccgtg gggcaacctgccgaccatcctggcgatcgagttcctggccatcgccttcg cggagcagcagcgcaccatggagaaggacccggagaagaagaagtacccc ggcggcgccttcgacccgctcggcttctccaaggaccccgccaagttcga ggagctcaagctcaaggagatcaagaacgggcggctggcgatgctggcgt tcgtggggttctgcgtgcagcagtcggcgtaccccggcaccggcccgctg gagaacctggccacgcacctcgcggacccgtggcacaacaacatcggcga catcgtcatccccagaaatatctacggcccttga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.