Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TP4899

Sequence	TP4899
Locus	TP4899
Species	Aegilops umbellulata
DNA	tgcagaggcgcggcacagcgaggcggcgtggaggcgctgcacgtctgcgt tggtgcgtgcaatg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.