Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TP1517

Sequence	TP1517
Locus	TP1517
Species	Aegilops umbellulata
DNA	tgcagaagatgaggaggcgtgtcgacggggagcttcgcgcggctgatgct ggctcggatccgca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.