Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TP20951

[Submit comment/correction]

Sequence	TP20951
Locus	TP20951
Species	Aegilops umbellulata
DNA	tgcagcggcacgtggggagccgccaccaccaccaccctccctatgctcct ttgcccgcctgcta

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.