Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GMI_ES01_c13550_331

[Submit comment/correction]

Sequence	GMI_ES01_c13550_331
Species	Avena sativa
Probe	GMI_ES01_c13550
DNA	tgcctggccttcgcgcctgccaggagcgccgccatcatcgggaacacgca gcagcagtccYtcagcgtcgtctacgacgtcaagagcaacaggatcggct tcgccgccggcggctgcaagt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.