Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig2000_1193707

[Submit comment/correction]

Sequence	wsnp_RFL_Contig2000_1193707
Probe	wsnp_RFL_Contig2000_1193707
DNA	TGCCTTCGCTGGTGCCGCGGGGGTTGAAGAGCGCGAACATATCAAGACCG Mcaccag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.