Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig2449_2013497

Sequence	wsnp_RFL_Contig2449_2013497
Probe	wsnp_RFL_Contig2449_2013497
DNA	GGAATGGATGAAAGAAGCTTCTCATAGGATGCATCAATGGTAGGAACAGG Rccattgacag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.