Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BE490271

[Submit comment/correction]

Sequence	BE490271
Contig	Ta.5064.1.A1_at NSFT03P2_Contig16287
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC317712
NCBI UniGene	Ta.5064
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001050945.1 Os03g0689100 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Wheat cold-stressed seedling cDNA library
Tissue	Seedling
Developmental Stage	Five-day old seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0359_E10_I19ZS Wheat cold-stressed seedling cDNA library Triticum aestivum cDNA clone WHE0359_E10_I19, mRNA sequence.
Other Name	WHE0359_E10_I19ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA007E1X
Clone	WHE0359_E10_I19
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were transferred to 5 C cold room and kept for 48 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were transferred to 5 C cold room and kept for 48 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	gaaacagttactgcacaagtcaagctgcttgctgaaggcgaagaggagaa gcttgcgctgacaagctcattttctagatacgaccaagcaaaggctcttg ggaaaacgacaattgatgttgctcgtattgctgctggtttaccttgtggt agtgaaagcttcctcttgatgtttgctcgatggaaaaaacttgagagaga tttatataatgaaagaaaggaccgatttgacattacacagattccagatg tctatgactcgtgcaaatatgacctcgtgcataatgctcatctcaatctt aagggtttggaagagctttacaaagttgctcaacttcttgctgatggtgt tattccaaatgagtacgggatcaacccaaagcaaaaactaaaaattggat caaagatagcacgccggttaatgggaaaagttctaattgatttacggaac actcgtgaagaagctatttgtgttgctgacccgaagtttactgaagatga agctttattcctaccaacaaaagaagtagagcaccagcaaaagattcaag ta

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.