Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BE492686

[Submit comment/correction]

Sequence	BE492686
Contig	NSFT03P2_Contig13639
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Triticum monococcum
Keyword	EST
Germplasm	T. monococcum ssp. monococcum DV92
Species	Triticum monococcum
Cultivar	DV92
Clone Library	Triticum monococcum vegetative apex cDNA library
Tissue	Vegetative shoot apex
Developmental Stage	Three weeks-old plants
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0561_B12_B12ZE Triticum monococcum vegetative apex cDNA library Triticum monococcum cDNA clone WHE0561_B12_B12, mRNA sequence.
Other Name	WHE0561_B12_B12ZE  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli XLOLR
DNA Library	TM011XXX
Clone	WHE0561_B12_B12
Remark	DB_xref: taxon:4568 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene T3 primer. Note: Vector: Lambda pBK-CMV (Lambda Zap Express), excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova , J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda pBK-CMV (Lambda Zap Express), excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tcggcacgagggcgagatgaagctcaccgtgatgaccgccgacgagcagt ttctcaacctcgacgtcgaccccgacgaatccgtggagaatttgaaggcg cttcttgaggtggagactcaagtgccgttgcagcagcagctgcttcattt caatggcaaggagatgaacaatgctgagaagctcagcgccatcggagtcc atgatggtgatcttgtgatgatggttgcctccaataataggacatctcag gatattatgaggttaaatcctgatggatcggcagtaaatcctcaagcttt ccaacaacatattcgtggcgattcacaacttatggcgcaactccttcaga atgacccttcattagctcaagccatccttggagatgacatcactgagttg caaaacatcttgcggtcacaccaccaacaaagactacaactgaaacgcaa acaggaagaagagcttgccttattgtatgccgatccatttgatgtcgagg ctcagaagaaaattgaagctgcaattcggcagaaaggcattgatgaaaat tgggaggctgctatagagcataatcctgaagcatt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.