Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BE494102

Sequence	BE494102
Contig	NSFT03P2_Contig12406
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC4119
wEST map position	BE494102
DB Remark	Locus Source: Secale cereale (rye)
Keyword	EST
Germplasm	Blanco
Species	Secale cereale
Cultivar	Blanco
Chromosome	5AL 5BL 5DL
Clone Library	Secale cereale anther cDNA library
Tissue	Anther
Developmental Stage	Adult plant before anthesis
Data Source	genbank Release 135, Apr 15 2003 genbank Downloaded 2008-2009
Title	WHE1277_H01_P01ZS Secale cereale anther cDNA library Secale cereale cDNA clone WHE1277_H01_P01, mRNA sequence.
Other Name	WHE1277_H01_P01ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	SC024E1X
Clone	WHE1277_H01_P01
Probe	WHE1277_H01_P01
Remark	DB_xref: taxon:4550 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Anthers were harvested and pooled from early meiosis to late meiosis. The tissue, total RNA, and poly(A) RNA were prepared (Butler, Ross and Gustafson) at University of Missouri, Columbia. A cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.6397.1.A1_at 617 WHE2AFFY [ Show all 19 ]
DNA	ccgcggtgttcttcaagaactctgctgacggcggctgctcctcggccaag gagatgaccaaggtctcggggatctctgctatcatccctgagatggagat ctgcgacttcgacttcgacccatgcggctactcgatgaacggcgtctgtg ggccggcggcctccacgatccacgtcactcccgaggaaggattcagctac gcgagctatgaagcgatgaacttcaaccctggctccctggcctacagtga cctgatcaagagggtgctgtcatgcttccgcccgtcagacttctccgtcg ccgtcaccatcttcggtggccaaggcttcgccaaatcatgggcggccggt gcggaggctggctcctcctacctgctcgaggatgccgtcgagcaggagct tccgggcggtggcctgctcatgtaccagagcttcagtgcggttgccccgg gcgccgtgtcgccaaggtcgaccttggatgatggctggagcagcgacggg atggagacggccgccaagggcgaggacgcgtgcgtctggggagtggagaa gaaggttgccaagaaagatgtcgctgcctgagaaacatctgcggttccag agacgtctgaagtttctgggacgtgtgttggtattctgctatggtagtgt cg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.