Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BE518124

[Submit comment/correction]

Sequence	BE518124
Contig	NSFT03P2_Contig10147
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC311176
DB Remark	Locus Source: Triticum aestivum (bread wheat)
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Wheat vernalized crown cDNA library
Tissue	Crown tissue of seedling
Developmental Stage	Five-week old seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0811_D02_H03ZS Wheat vernalized crown cDNA library Triticum aestivum cDNA clone WHE0811_D02_H03, mRNA sequence.
Other Name	WHE0811_D02_H03ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA016E1X
Clone	WHE0811_D02_H03
Probe	[BE518124.1] {SpCl-1093}
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were germinated and grown at 4 C for 5 weeks. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ccctccgaaagggcaaaccgtcggaaccctagatccgtcgcgcctggtcg cccccagctccaaaaccctagatcccgccatgcaccacccgagggcccgg tacccgcccggctacgactacggcggcggtggccgcggtggtaacggcgg cggcggcggcggcggtggaggaggtggcggcgggaaccaaaactactacg gcgggcgaaacccgcatccccagcaccacgattaccagcagcagcagcag cagcacgcgcagaggaactcgttcccgcagcagcagcagcagcagcacgc gcagaggaactcgttctcgcagcaacagcagcagcagcatcagcaacaac agcatcagcagtggctgcggcgggaccaggccgcggcccaggcttcagga gagggtgcggccaggacggtggcgcgactcgacgcggtggacacgagctc tcaagattggaaggcacagttgaatattccagctccagatactcgtttta ggacagaggatgttactgcaacgaaaggcaatgagtttgaagattatttt ttgaaacgtgagctacttatgggaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.