Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: avgbs_44997

[Submit comment/correction]

Sequence	avgbs_44997
Species	Avena sativa
Probe	avgbs_44997
Remark	SNP = [C/T]
Type	SNP
DNA	TGCAGCCCCCACACCAGGTCCGYTACTACTACAGTACTACTTCCGATCCA GTCACCTCATCCTT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.