Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BF263651

[Submit comment/correction]

Sequence	BF263651
External Databases	Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene	Hv.23439
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Transcribed locus, moderately similar to NP_001063570.1 Os09g0499000 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	CI16155 (Mla13)
Clone Library	Hordeum vulgare seedling green leaf EST library HVcDNA0004 (Blumeria challenged)
Tissue	seedling green leaf
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	HV_CEa0007E22f Hordeum vulgare seedling green leaf EST library HVcDNA0004 (Blumeria challenged) Hordeum vulgare subsp. vulgare cDNA clone HV_CEa0007E22f, mRNA sequence.
Strain	lab_host TJC121 vulgare
Clone	HV_CEa0007E22f
Probe	BF263651
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: On Nov 17, 2000 this sequence version replaced gi:11194645.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 353; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 798. Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; C.I. 16155 (Mla13) plants were greenhouse grown in the R Wise lab at Iowa State University, Ames, IA; 7 day old green seedlings were challenged with isolate A27 (AvrMla13 ) of Blumeria graminis f. sp. hordei, and leaves were harvested 20 and 24 hr post-inoculation and snap frozen; uninoculated leaves were harvested 20 hr post-inoculation (Wei, Wise). In the TJ Close lab at the University of California, Riverside, total RNA was prepared from each sample pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids (Choi, Close). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http: Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; C.I. 16155 (Mla13) plants were greenhouse grown in the R Wise lab at Iowa State University, Ames, IA; 7 day old green seedlings were challenged with isolate A27 (AvrMla13) of Blumeria graminis f. sp. hordei, and leaves were harvested 20 and 24 hr post-inoculation and snap frozen; uninoculated leaves were harvested 20 hr post-inoculation (Wei, Wise). In the TJ Close lab at the University of California, Riverside, total RNA was prepared from each sample pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids (Choi, Close). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
DNA	gaggctttccagtcctacggtgggttccccggatcggggaggaccaaggg ggacgcgctgctcggcaagaagatgagcgacgggttcttcatcgaggagg aggaggaggatgaggcggaggaggtgctgaccgagagctccttcatcggc gcgccgtcgccgtcgagctcctccatcggcgaggactgctcgtcggaggt tggtggcgatggtgaagacgatgaggtggagagcaagctcaaggaggagc ccgggctcggctgcctggacgccttggaggactccttgcccatgaagaac ggactgtcgagcttctacgccggcaagtccaagtccttcaccagcctcgc cgaggcggcggcgcgggacgccgtgaaggagctggccaagccggagaacc cattcaacaagcgccgccggatcctggccacctggtcgcgccgcgcctcc tgcagctcgctggcgacggccacctacctgcccccggtcctggcccccga ccacgcactcccccgagggggaccaaggccacgaggacgacgactccgac tccgggttcgacaagcagcaccgggccaagaacgggtgggaggcgccggc attgccggcccccgaggctcatggtgaacacccatacgggcgccgcagca ggccgcaaggaggggcggcaactttaggtctccgaggccttacttggtgg tcaaatctttggaacgggggcgatggcatgttataaccattaagctgaaa attcttaggcaaccacaccggcctgggataggaccccttctcgagggtcc ccgtacagcctgtgtgaaatgcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.