Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AJ303115

[Submit comment/correction]

Sequence	AJ303115
Subsequence	AJ303115_1.cds 1 188
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC183051
NCBI UniGene	Hv.22171
Data at Gramene	Gramene-Protein Q9FEX5
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Lectin, clone 4A-HL#2-R'
Keyword	hl#2 gene lectin
Species	Hordeum vulgare subsp. vulgare
Cultivar	apex
Tissue	etiolated coleoptile
Developmental Stage	day 6
Data Source	genbank Release 135, Apr 15 2003
Title	Hordeum vulgare partial mRNA for lectin, clone 4A-HL#2-R.
Clone	4A-HL#2-R
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Gene: HL#2 Locus Comment: under investigation.
EMBL Feature	feature_gene 1 188 Location: 1..188
DNA	ggccgtggggcgggacgcggccggccacgaccccgccgggtggcgcgcgg ggaggacgtggaagagcagcagcgtctggagcgacctcaggttgcggggc tccagcaggaagcgcttgaactccgggtcgaggtcccgctccagcgcctc gttccggggcgcgaagatggtgacgtcgtgccgcccca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.