Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: oPt-13724_M

Sequence	oPt-13724_M
Locus	oPt-13724_M
Species	Avena sativa
Reference	Tinker NA et al. (2009) New DArT markers for oat provide enhanced map coverage and global germplasm characterization BMC Genomics 10.
DNA	ATCTGGAGAAGGTTCTGTTGTGTCCTGCTTTTACTTTCTTATGTGAAACT TGTGTGCTGCCCCTTGAACTTACCTAATGTT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.