Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BF473859

[Submit comment/correction]

Sequence	BF473859
Contig	Ta.10874.1.S1_at NSFT03P2_Contig6391
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC346821
wEST map position	BF473859
NCBI UniGene	Ta.10874
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	2BS
Clone Library	Wheat 5-15 DAP spike cDNA library
Tissue	Spike
Developmental Stage	Adult plant
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0932_B07_D14ZS Wheat 5-15 DAP spike cDNA library Triticum aestivum cDNA clone WHE0932_B07_D14, mRNA sequence.
Other Name	WHE0932_B07_D14ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA018E1X
Clone	WHE0932_B07_D14
Probe	WHE0932_B07_D14
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 5, 10 and 15 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors ). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 5, 10 and 15 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.10874.1.S1_at 765 WHE2AFFY Ta.10874.1.S1_at 482 WHE2AFFY
DNA	ctccatcgcgcacaccggtgacgctgacctctgccgtccgtcctctgcat cgccgctgacctccggctccgccctctttcctccacgccgttgagtcgcc gactcgctgacatccgctgctccttcctccgtcgcgctcgccgacgcgct gtggcgtggagcaacacgagccgtcgacgccatcatggtgttcgagggtg ggaaccttggtgctggttatgttgctagtcaaggttccctacctgaaaca caacctgatgttacccctgacagtgttagcaagaaaaggaacaagaggtc aaaggcatggacacacttcacaattcaggtggatgatccggatcatgcaa actgcaactaaatttgtttcttcatgtagcagaaccatgtcttgatcaga agttcgcgtcaactttggt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.