GrainGenes Sequence Report: BF622669
Sequence
BF622669
External Databases
Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene
Hv.26472
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'CDNA clone: FLbaf31p01, mRNA sequence'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
Morex
Clone Library
Hordeum vulgare seedling shoot EST library HVcDNA0001 (Cold stress)
Tissue
Seedling shoot
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
HVSMEa0007L06f Hordeum vulgare seedling shoot EST library HVcDNA0001 (Cold stress) Hordeum vulgare subsp. vulgare cDNA clone HVSMEa0007L06f, mRNA sequence.
Strain
lab_host TJC121 vulgare
Clone
HVSMEa0007L06f
Probe
[Bcl108ct392cn1695] {SpCl-194} BF622669
Remark
DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: On Dec 18, 2000 this sequence version replaced gi:11886403.; Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 265; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 270. Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Seeds were surface sterilized then germinated under axenic conditions in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were incubated at 5oC for 2 days. Shoots were then harvested, total RNA was prepared, poly(A) RNA was purified, one primary unamplified cDNA library was made, and 600000 pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close laboratory at the University of California, Riverside (Choi, Close, Fenton). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations , DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main ). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http: Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Seeds were surface sterilized then germinated under axenic conditions in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were incubated at 5oC for 2 days. Shoots were then harvested, total RNA was prepared, poly(A) RNA was purified, one primary unamplified cDNA library was made, and 600000 pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close laboratory at the University of California, Riverside (Choi, Close, Fenton). Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing). Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
DNA
cagaccgcgccgcgccgccgccgccgctccacccagcgttcgggttgctc
gccgccggcgagctcgtgccgcaactccaccatgaagctgaacatcgcga
accccaccacggggtgccagaagaaggtcgagatcgatgacgaccagaag
ctgcggaacctttatgacaagagaatctcccaggaggtagttggttatct
tctgggtgaggaattcaagggttatatcttcaagatcatgggtggctgtg
ataagcagggcttcccgatgaaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: BF622669
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
