Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BG275007

[Submit comment/correction]

Sequence	BG275007
Contig	Ta.5210.2.S1_a_at Ta.5210.2.S1_at NSFT03P2_Contig565
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC318013
wEST map position	BG275007
NCBI UniGene	Ta.54663
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001051098.1 Os03g0719900 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	4AL
Clone Library	Wheat salt-stressed crown cDNA library
Tissue	Crown
Developmental Stage	Adult plant
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2120_F02_L04ZS Wheat salt-stressed crown cDNA library Triticum aestivum cDNA clone WHE2120_F02_L04, mRNA sequence.
Other Name	WHE2120_F02_L04ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA038E1X
Clone	WHE2120_F02_L04
Probe	WHE2120_F02_L04
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA and poly(A) RNA were prepared from crown tissue, equal portions of RNA were pooled from the two treatments, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.5210.2.S1_at 888 WHE2AFFY Ta.5210.2.S1_a_at 888 WHE2AFFY Ta.5210.1.S1_at 182 WHE2AFFY
DNA	tctctcttgtacgagctagcagatggggtttcagcaatcgaaggagtcgg caattggagcacactgatgaactcagatgtctggacaaggcggctacaat tactgatcttgatgtgaaagaagatagcttcaacaacccatggcgggtgt gcaccgtcacccaggtggaggaactgaagatattggtaaggatgttccct gtctgggcaacaacaattgtgttttcggccgtctatgctcagatgtccac catgtttgtggaacaagggatggtgcttgatccaacaatcggctcattca agatccctccagcatctctatccaccttcgacgtggtcagtgtcattata tgggttcctatctatgacagcatcctggtcccaatagccaggaggttcac cggcaaggagaggggcttttcagagctccagcggatgggcatcggcctgg taatctccatcctcgcaatgtcagcagccgcggtcctcgagataaagagg ctggccatcgccagggaggcgcacctggtggaccagaacgtcccggttcc gctgagcatcctgtggtaaatccctcactacttcct

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.