Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BG313394

[Submit comment/correction]

Sequence	BG313394
Contig	Ta.3507.1.S1_at Ta.3507.2.S1_a_at NSFT03P2_Contig8542
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC296157
wEST map position	BG313394
NCBI UniGene	Ta.37507
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, weakly similar to NP_001051161.1 Os03g0730400 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Germplasm	Chinese Spring
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	4AL 4BS
Clone Library	Wheat salt-stressed sheath cDNA library
Tissue	Sheath
Developmental Stage	Adult plant
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2060_D08_G16ZS Wheat salt-stressed sheath cDNA library Triticum aestivum cDNA clone WHE2060_D08_G16, mRNA sequence.
Other Name	WHE2060_D08_G16ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli SOLR
DNA Library	TA037E1X
Clone	WHE2060_D08_G16
Probe	WHE2060_D08_G16
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA was prepared from sheath tissue, equal quantities of RNA were pooled from the two samples, polyA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin , Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA was prepared from sheath tissue, equal quantities of RNA were pooled from the two samples, polyA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	Ta.3507.1.S1_at 1102 WHE2AFFY Ta.3507.1.S1_at 496 WHE2AFFY TaAffx.122548.1.S1_at 80 WHE2AFFY TaAffx.122548.1.S1_at 78 WHE2AFFY TaAffx.119839.1.S1_at 48 WHE2AFFY
DNA	ttctccggacgcccaccgcccggcgacgccaccacttgccggtgctgcat ctcgttgccgtcctcctgcttgtgccgctctcacggccggcctcggcgtc ggcgtcgacggtggtcacccacctgccaggattcgatggccctctcccct tctacctcgaaaccggatacgtgggcgtggaggaggagaccggggcggag ctcttctactacttcgccaagtcggagcggagccccggcaccgaccccgt catcctgtggctcaccggcgggcctcgctgctcgggcttcagcggcttcg ccttcgaagttggccccgtaaagtatgtgcgggcgccgtacactggagtt ttgccgcggctggtacagaacccgctgtcatggaccaagatggcgagcat catcttcctggattcgcccgtctgctcgggcttctcgtatgctcgtgacc ccaaaggctgcgatgtcggagactactcgtcctctctgcaagtccaaaga ttcctgaataagtggttcactcatcacccgcagtacctttcaaatccttt ctacct

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.