Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ta.7645.2.S1_a_at

Sequence	BG314263
Contig	Ta.7645.2.S1_a_at
Tracefile	[ Download ] [ View ]
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Triticum monococcum
Keyword	EST
Germplasm	T. monococcum ssp. monococcum DV92
Species	Triticum monococcum
Cultivar	DV92
Clone Library	Triticum monococcum early reproductive apex cDNA library
Tissue	Early reproductive apex
Developmental Stage	Seven week-old plants
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2461_C09_F17ZS Triticum monococcum early reproductive apex cDNA library Triticum monococcum cDNA clone WHE2461_C09_F17, mRNA sequence.
Other Name	WHE2461_C09_F17ZS  [ wEST-mySQL (obsolete) ]
Strain	lab_host E. coli XLOLR
DNA Library	TM043E1X
Clone	WHE2461_C09_F17
Probe	BG314263
Remark	DB_xref: taxon:4568 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequence have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: Stratagene SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared from apex at double-ridge stage to terminal-spikelet stage during transition from vegetative state to flower state, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova , J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; The tissue, total RNA, and poly(A) RNA were prepared from apex at double-ridge stage to terminal-spikelet stage during transition from vegetative state to flower state, a cDNA library was made, and the cDNA clones were in vivo excised at the University of California, Davis (V. Echenique, B. Stamova, J. Dubcovsky). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA Homology	TaAffx.109047.1.S1_at 313 WHE2AFFY Ta.7645.3.S1_at 281 WHE2AFFY Ta.7645.3.S1_at 248 WHE2AFFY Ta.7645.3.S1_x_at 281 WHE2AFFY
DNA	caagccacccctcccgccgccgctggcgtcgacctatccccggcggcgac cgacctcggccgggtgcacctcctgccctgcggcatcaggcacaacagcg ccgccgccgtctccgactacttcaagccgagggacactggcgtggaggtg gatggggtgaaggtggaggaggc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.