Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BG344020

[Submit comment/correction]

Sequence	BG344020
External Databases	Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene	Hv.11347
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Transcribed locus, moderately similar to NP_001066614.1 Os12g0298600 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	Morex
Clone Library	Hordeum vulgare pre-anthesis spike EST library HVcDNA0008 (white to yellow anther)
Tissue	pre-anthesis spike
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	HVSMEg0007G15f Hordeum vulgare pre-anthesis spike EST library HVcDNA0008 (white to yellow anther) Hordeum vulgare subsp. vulgare cDNA clone HVSMEg0007G15f, mRNA sequence.
Strain	lab_host SOLR vulgare
Clone	HVSMEg0007G15f
Probe	[BG344020.1]
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Wing RA; Clemson University Genomics Institute; Clemson University; 100 Jordan Hall, Clemson, SC 29634, USA; Tel: 864 656 7288; Fax: 864 656 4293; Email: rwing@clemson.edu; Total hq bases = 405; Seq primer: AATTAACCCTCACTAAAGGG; High quality sequence stop: 747. Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spike with awns trimmed were collected at white, green and yellow anther stages (Fenton). Total RNA was prepared from each pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close lab (Choi) at the University of California, Riverside. Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing) Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch , Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http: Note: Vector: lambdaZAP; Site_1: EcoR1; Site_2: Xho1; Plants were grown in the greenhouse at the University of California, Riverside (Fenton, SJ Close, TJ Close). Whole spike with awns trimmed were collected at white, green and yellow anther stages (Fenton). Total RNA was prepared from each pool, equal quantities of all three RNA pools were combined, poly(A) RNA was purified from the mixture, one primary unamplified cDNA library was made, and 1 million pfu were in vivo excised to give pBluescript SK(-) cDNA phagemids. These steps were performed in the TJ Close lab (Choi) at the University of California, Riverside. Phagemids were plated and picked at the Clemson University Genomics Institute (CUGI) (Begum, Palmer, Frisch, Atkins and Wing) Plasmid DNA preparations, DNA sequencing and sequence analysis were performed at CUGI (Wing, Yu, Frisch, Henry, Simmons, Oates, Rambo, Main). The sequence has been trimmed to remove vector sequence and contains a minimum of 100 bases of phred value 20 or above. For more details on library preparation and sequence analysis see http:
DNA	gaaccaatggactcagggggcggaggaggggggtctcacaaggccgcgtc gggctccgcgccgtcggtggcggcggcggcggcggccccgaaccccacgg cgatgctctcggccctgatgggcaagcgcgccaagctccaggaggaggtc cgctccatcgagcggcaggtttatgatatggagaccacctacctgcaaga gtctaatcaatttggaagcgtgctgaagggttttgaatcattcttgtcat catcaaaaaacactgctaacctcaagcggtccaggaagtttcaggttgat gagaggctattctctctgtcatcagttacttctccagcgggtgaagaaca actggctgcacgagacgaggcaagagaatatgcaggtcgttcgaagggcg caagcactccagctaatggccaagggaaaccaaaaaagggagggcgtcct ggaggaagagacggtaagaaaatacgcccatcgggatgatccangacttg gacaacgaagatgactactagcccctgggtgggagagggcgtcagatagc tagaggagtaagaggagaggccggatagagagtgaagggataaggggcag aggccatgggggggagggggtgcgggcaagactgaaggaatagcagaaag ggggcccgcgggaatgcgtgaggaagctgagagaggaatagagaaaaaaa ggaagggagtgggagtgggggggggagagagaggggaggaggggggggga gagggaggaaggagggtagaggggagggggaggggagagggggggggagg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.