Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig1865

Sequence	BQ160798
Contig	Ta.7851.1.S1_at NSFT03P2_Contig1865
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC335875
wEST map position	BQ160798
NCBI UniGene	Ta.42018
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001049368.1 Os03g0214000 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	2BS
Clone Library	Wheat unstressed seedling shoot cDNA library
Tissue	Etiolated shoot
Developmental Stage	Five day old seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0328_H08_P16ZT Wheat unstressed seedling shoot cDNA library Triticum aestivum cDNA clone WHE0328_H08_P16, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE0328_H08_P16
Probe	WHE0328_H08_P16
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Shoots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Shoots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ttttttttttttttttttttttttttggaaaccttcaaaaaattgaattc aaaacactctgcatgggtttctcggccatcgatgaacaccacagcatatc tatccaagtttcatgaagagaacaaaattgcatccatcgattcaacaaca gcagaaccgagccgcatcaaacggagcggtgctctaagacgccatggtgg tggcggcgcagttgtcgacgccgcaggcgaggacgtcgcggtagtcgcgc gagacggtgaagctgtcgcgcacgctgccgtccctgctccgcttgtactc catgagcagcgtggtgtggttgaacgccgtcagcttggcgaacccgtagt ccaggtcctgcgcgtggctccaccgcgcccgctccgccgtgtactccgcc aggctcgccccgccgccgccca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.