Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BQ161821

[Submit comment/correction]

Sequence	BQ161821
Contig	Ta.3168.1.S1_at Ta.3168.2.S1_s_at NSFT03P2_Contig14751
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC291015
wEST map position	BQ161821
NCBI UniGene	Ta.53912
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001042198.1 Os01g0179300 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Sumai3
Chromosome	3AS 4AL
Clone Library	Wheat Fusarium graminearum infected spike cDNA library
Tissue	Spike
Developmental Stage	Adult plant
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0481_C08_F15ZT Wheat Fusarium graminearum infected spike cDNA library Triticum aestivum cDNA clone WHE0481_C08_F15, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE0481_C08_F15
Probe	WHE0481_C08_F15
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20. No effort was taken; to identify ESTs of fungal origin from this library, thus this EST; could be of wheat or fungal origin.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes were sprayed at anthesis with Fusarium graminearum. Total RNA, and poly(A) RNA were prepared and pooled from infected spike at 0, 6, 12, 24, 36 and 48 hours after inoculation, a cDNA library was made , and the cDNA clones were in vivo excised to give pBluescript phagemids in G. Muehlbauer lab at the University of Minnesota (Kruger, W.M., Muehlbauer, G.J., Pritsch, C., Vance, C.). The cDNA library should contain genes of both wheat and fungal pathogen origin. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes were sprayed at anthesis with Fusarium graminearum. Total RNA, and poly(A) RNA were prepared and pooled from infected spike at 0, 6, 12, 24, 36 and 48 hours after inoculation, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in G. Muehlbauer lab at the University of Minnesota (Kruger, W.M., Muehlbauer, G.J., Pritsch, C., Vance, C.). The cDNA library should contain genes of both wheat and fungal pathogen origin. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tttttttttttttttttttttttttacccaagaggccctgttggccatgt tgttgtctatcataagttcaaccggatcaacacaattcaaaacacaatta caacgaccgttctggtgaccacgaaggccttccagaattccgaaaccgaa tatcagaaaggcgctccatggtcaccataaatacacaactctggggagga ctggatggggaaaaatttattgcgacgggtccaaaacgaacaaggggatc attcattatcgaaactcaggagcatctcaaaacttgggcggcccgtcgcg tttttaccgcacgggttgctggttgtaatggctcttctccttcttctttg ccgccacgagcctggcggtcctggctgccgcctctgccgcggcgatcttt gcagctgtgtccgtctccttgcccgacttcttcttcttcatcgacgccat cttctttaggcgctccttgacatccacagccgtgtcttcctcgggttctg cactggcagcctcctccaacacttcagcttcctttgcctcctttgcgctc ttgtccttcttgttcttcttcttcttggcattcttgctctctaaaggggc aggtgcgtcttcctttctctctccatcaccagcttggctcgcacctttct tctcagcattgttgtttcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.