Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig14179

[Submit comment/correction]

Sequence	BQ167224
Contig	Ta.4605.3.S1_a_at NSFT03P2_Contig14179
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC294703
wEST map position	BQ167224
NCBI UniGene	Ta.4605
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001045729.1 Os02g0122800 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Cheyenne
Chromosome	6AS
Clone Library	Cheyenne wheat endosperm cDNA library Wheat endosperm cDNA library
Tissue	Cheyenne endosperm Endosperm
Developmental Stage	5 -30 days post anthesis seed 5 to 30 days post anthesis seed
Data Source	genbank Release 136, Jun 15 2003 genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE0055_H12_O23ZK Cheyenne wheat endosperm cDNA library Triticum aestivum cDNA clone WHE0055_H12_O23, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE0055_H12_O23
Probe	WHE0055_H12_O23
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: Stratagene's KS primer. Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, Cheyenne endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab. Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Seeds collected, endosperm isolated, and RNA prepared by Susan Altenbach. Library constructed by Stratagene, Inc. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab.
DNA	cgattcggcacgagcccgtctctgtcctccccgctcccttcgccgccggg tccaaaccgaaggagccgcgcccgtggaaacctagggtttcgccgtcccc gccctccaaaggtttttggagaagagctgtttgttcagcgacatgaggcc aattttctgcgggaaccttgactatgatgcccgccagtctgaaatcgagc gtcttttcggcaaatatggaagagtggagcgagttgacatgaagacagga tttgcgttcgtctacatggaagatgaacgtgatgctgaagatgctatcca tagacttgacagaactgactttggtagaaaagcgaggagactgagagtcg aatggacaaaggaggatcgcagtggtggtcggaaaggaaatgggaagaga tctccaagcagcgtgaaaccaaccaaaaccttgtttgtgattaactttga tccgatcaacacaaggacaagagatctggagaagcactttgatctgtat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.