Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ta.3876.1.A1_at

[Submit comment/correction]

Sequence	BQ172138
Contig	Ta.3876.1.A1_at NSFT03P2_Contig8101
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC361856
wEST map position	BQ172138
NCBI UniGene	Ta.3876
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001044452.1 Os01g0783200 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	3AL
Clone Library	Chinese Spring wheat drought stressed leaf cDNA library
Tissue	Leaf
Developmental Stage	Full tillering stage
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2013_A11_A21ZT Chinese Spring wheat drought stressed leaf cDNA library Triticum aestivum cDNA clone WHE2013_A11_A21, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2013_A11_A21
Probe	WHE2013_A11_A21
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton , Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ttttttttttttttttttttttttatttttttttttttttttttgccata cacaaacagccttgccagcaaaaggatcttacaggggcaacgtccactgc tcgacaaaatcagtgcaacgatctatctcctacgcaggacaaactgtaca gggcccagttagagattcaagcttctactgtttttttcacatcattcatg taccggaacgacaaggcggccccgaagttcctccgctcctctgtgaagtc atcgtccgagtcatcgctggagctggaatctgtgcaggttgttgacatag gggagtcgttgatgcctttggctatacagtccttggttgcgagcatcttg acctgcccagcgtgggatatctccacgacaaccttgccgtcatcctcctg tggaagaggctgcttccagggctcaccgtcgattctcatgtaggcatggt cagttgcaccccggtgaaatttgaatcggacacgatgggcctg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.