Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BQ172201

[Submit comment/correction]

Sequence	BQ172201
Contig	Ta.7088.1.S1_at NSFT03P2_Contig14888
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC281328
wEST map position	BQ172201
NCBI UniGene	Ta.54211
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001131692.1 hypothetical protein LOC100193052 [Zea mays]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	1AL 1BL 1DL
Clone Library	Chinese Spring wheat drought stressed leaf cDNA library
Tissue	Leaf
Developmental Stage	Full tillering stage
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2011_E02_J03ZT Chinese Spring wheat drought stressed leaf cDNA library Triticum aestivum cDNA clone WHE2011_E02_J03, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2011_E02_J03
Probe	WHE2011_E02_J03
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton , Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	atactgaagacaaaccatacacgaccgtagcggatacaacactcgacata cagctcttgctgaatggggatttcactcttggcacagttttagcaggttt gaacaaggatttcggtggtacatatagcagtagtgatggtgatgtataca tctccatattacaacatcagtgccgcattctaagcagcaacgagtgtggt cactgccggaacctggacttgccccggagttgccagctgactgatgttcg ccggacgaatccggccgcttgcgagcccggcagtcaggtcctccacttcc actttcaatacgtctcggcggttgccaatgtcacctgcgtacctgctgac acagtacaccccgactgccatcaccgccactccatagatgttcgtggtta ctaggcggaaaggggtcgaaaccacagcagcaagagg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.