Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ta.4170.1.S1_x_at

Sequence	BQ172269
Contig	Ta.4170.1.S1_at Ta.4170.1.S1_x_at Ta.4170.2.S1_x_at NSFT03P2_Contig5223
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC283481
wEST map position	BQ172269
NCBI UniGene	Ta.33217
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001050937.1 Os03g0687000 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	4AL 4DS
Clone Library	Chinese Spring wheat drought stressed leaf cDNA library
Tissue	Leaf
Developmental Stage	Full tillering stage
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2015_G01_N01ZT Chinese Spring wheat drought stressed leaf cDNA library Triticum aestivum cDNA clone WHE2015_G01_N01, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2015_G01_N01
Probe	WHE2015_G01_N01
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton , Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were given a gradual stress down to 80%, 70% and to 60% RWC at Texas Tech University (D. Zhang in HT Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ttttttttttttttttttttttttttttcccccgcccacttcatctatag attgattgatcgatttcataacagcagaaccaaaaaattataagaacgca aaagggaaatagctactgtggtataagacacgtgaattaatcacctgacc ttattctacccccttcttttgatcatccaaattgcatcaagcatccctgg tccccttgaacctgtaccacctggcgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.