Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig8581

[Submit comment/correction]

Sequence	BQ752995
Contig	NSFT03P2_Contig8581
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC343247
NCBI UniGene	Ta.36672
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001050127.1 Os03g0353400 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	Wheat salt-stressed root cDNA library
Tissue	Roots
Developmental Stage	Full tillering
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE4121_F11_K21ZS Wheat salt-stressed root cDNA library Triticum aestivum cDNA clone WHE4121_F11_K21, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE4121_F11_K21
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK(-); Site_1: EcoRI; Site_2: XhoI; Hydroponic plants grown to full tillering stage were treated with 150 mM NaCl for either 12 hours or 7 days. Root tissues of the plants subjected to both types of treatment were collected separately at University of California, Davis (E. Akhunov and K. Deal in J. Dvorak's Lab). Total RNA was prepared separately from the two samples (12h and 7day treatments), and equal amount of RNA was then pooled. PolyA RNA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK(-) phagemids in J. Dvorak's lab (E. Akhunov, J. Dvorak) at the University of California, Davis. Colony plating, plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tcggcacgaggcagatccatattctctatcctgactctgctcctgcgatc accaaccccaatccaaggccaacagcaacagggaaatcatgagcgccatg gtcgcgtcgtcgctcaaccctgaggccccgctcttcatcccggcagcgtt ccagcaggtggaggacttctcgccgcagtggtgggacctcgtcaagtcca ccgcctggtttcgcgaccactggtaccaccagcaccagcagctcgacgat atggccgattccctcatcgccttcgaggccgaggacgccatcgacgacga cctcttgcacggcttcgccgtcgaggcttcgcagccgcagccgccagcgg cactcaagagctgacggggtgctcaaggcgctgagcctggcatccccaag cccaaaggtcggcgacgccctgcgtgtctcctcggagaagcctaggtaca ccgagaagcccaccaagtagctggcagccctgaggagcggtggcgcaccg cgtttcatccaccagcctcgctagggttgggatgtcaagcttcaagaatc caccaaatcctgcgccttgtgtcatgcagtgatgcattgctctggctgct gccgccgtctcatctttcaagtcttcttctagtactcgcgcccagtaagt agtggcgtccgtttgtatattatattaagtagaaatgaaatgacccaaga aaaaggcaacaaaatgca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.