Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AJ555614

[Submit comment/correction]

Sequence	AJ555614
Subsequence	AJ555614_1.cds 20 253
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC169697
NCBI UniGene	Hv.11354
Data at Gramene	Gramene-Protein Q84L51
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Metallothionein-like protein type 4 (mt-4a gene)'
Keyword	metallothionein-like protein type 4 mt-4a gene
Species	Hordeum vulgare subsp. vulgare
Cultivar	Steffi
Tissue	primary leaves
Developmental Stage	37 days after sowing
Data Source	genbank Release 136, Jun 15 2003
Title	Hordeum vulgare subsp. vulgare mRNA for metallothionein-like protein type 4 (mt-4a gene).
Strain	vulgare
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Gene: mt-4a
EMBL Feature	feature_gene 1 400 Location: 1..400
DNA	aacgcctgaaaagatcgagatgggctgcgacgacaagtgcgggtgcgccg tgccgtgccccggcggcacgggctgcaggtgcacctcggcgaggagcggc gcggagcacaccacgtgcgcgtgcggcgagcactgtgggtgcaacccgtg cgcgtgcgggcgcgaggggacgccgtccgggcgggagaataggcggtcca actgctcctgcggcgcggcctgcaactgcgcttcatgcggctcgaccgcc tgatcgcgtcgacgcgccactagtcgtgaactgatgcaccagtagtcgag ctagctactgagttagccataaataagtgccgctgagccgtgatcagtca tgtgtgtgcgtgtcgggtactactaccttgtttgtgcgtgtgtggaaagt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.