Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AJ555615

Sequence	AJ555615
Subsequence	AJ555615_1.cds 1 222
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC179714
NCBI UniGene	Hv.30904
Data at Gramene	Gramene-Protein Q84L50
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Metallothionein-like protein (mt-1d gene)'
Keyword	metallothionein-like protein mt-1d gene
Species	Hordeum vulgare subsp. vulgare
Cultivar	Steffi
Tissue	roots
Developmental Stage	9 days after sowing
Data Source	genbank Release 136, Jun 15 2003
Title	Hordeum vulgare subsp. vulgare partial mRNA for metallothionein-like protein (mt-1d gene).
Strain	vulgare
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Gene: mt-1d
EMBL Feature	feature_gene 1 222 Location: 1..222
DNA	atgtcttgcaactgtggatcaagctgtggatgcggctcaaactgcaactg cggcaagatgtaccctgacttggaggagaagagcggcgccatcatgcagg ccaccgccgtcatccttggcgtcaggcctgcgaaggtgcggttcgaggag gtcgctgagtccggtgaggccggccacggctgcagctgtggcgccagctg caagtgcaacccttgcaactgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.