Query (optional)   in Class  

GrainGenes Sequence Report: NSFT03P2_Contig13831

[Submit comment/correction]

Sequence
BQ804782
Contig
Ta.26984.1.S1_at
NSFT03P2_Contig13831
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC294276
NCBI UniGene
Ta.26984
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, moderately similar to NP_001056834.1 Os06g0152200 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Butte 86
Clone Library
Wheat developing grains cDNA library
Tissue
whole grains
Developmental Stage
3-44 days post anthesis seed
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
WHE3559_A09_A17ZS Wheat developing grains cDNA library Triticum aestivum cDNA clone WHE3559_A09_A17, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE3559_A09_A17
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer.
Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Plants were grown under six following different environmental regimes in greenhouse, Environment 1) 24oC/17oC day/night, well-watered, with post-anthesis fertilizer, Environment 2) 24oC/17oC day/night, well-watered, without post-anthesis fertilizer, Environment 3) 37oC/17oC day/night, well-watered, with post-anthesis fertilizer, Environment 4) 37oC/17oC day/night, well-watered, without post-anthesis fertilizer, Environment 5) 37oC/17oC day/night plus drought, with post-anthesis fertilizer, Environment 6) 37oC/17oC day/night plus drought, without post-anthesis fertilizer, developing wheat grains from the following were excised and frozen in liquid nitrogen, Environment 1 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44 DPA Environment 2 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44 DPA Environment 3 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 32, 34 DPA Environment 4 at 3, 5, 7, 8, 10, 12, 16, 20, 24 , 28, 32, 34 DPA Environment 5 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 30 DPA Environment 6 at 3, 5, 7, 8, 10, 12, 16 , 20, 24, 28, 30 DPA and total RNA was prepared by S. Altenbach and K. Cronin at USDA-ARS, Albany, CA. A cDNA library was made using poly (A) RNA, and the cDNA clones were in vivo excised to give pBluescript SK(-) phagemids in the TJ Close lab (Chin, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (others).
Note: Vector: Lambda ZAP II, excised phagemid; Site_1: EcoRI; Plants were grown under six following different environmental regimes in greenhouse, Environment 1) 24oC/17oC day/night, well-watered, with post-anthesis fertilizer, Environment 2) 24oC/17oC day/night, well-watered, without post-anthesis fertilizer, Environment 3) 37oC/17oC day/night, well-watered, with post-anthesis fertilizer, Environment 4) 37oC/17oC day/night, well-watered, without post-anthesis fertilizer, Environment 5) 37oC/17oC day/night plus drought, with post-anthesis fertilizer, Environment 6) 37oC/17oC day/night plus drought, without post-anthesis fertilizer, developing wheat grains from the following were excised and frozen in liquid nitrogen, Environment 1 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44 DPA Environment 2 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 32, 36, 40, 44 DPA Environment 3 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 32, 34 DPA Environment 4 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 32, 34 DPA Environment 5 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 30 DPA Environment 6 at 3, 5, 7, 8, 10, 12, 16, 20, 24, 28, 30 DPA and total RNA was prepared by S. Altenbach and K. Cronin at USDA-ARS, Albany, CA. A cDNA library was made using poly (A) RNA, and the cDNA clones were in vivo excised to give pBluescript SK(-) phagemids in the TJ Close lab (Chin, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (others).
DNA
gttccaaataccaagacaggaatgaccaattggactatggacaacagtgc
actcagattggcagagcctccacctaagtacctgtcagatggaaattcaa
aacttctgctctctaatcagaccaccacagctttatccaaccaaatgaac
agagatagtggccgggcttacaacttaccattctcaggtggcaacgggtc
agacagtttacctgagtggcctgtggatgaattcttcagtaacttagaat
atggcccaaactttggcttcactgagcatggttcttccaagggtgacaat
gctaagctggggagtgctgggggatctccacagtgccgtctagctgaagg
cctgtttgcagaagacctgctaggccaggtacctggatttgatgctgagg
atccatgggtggtgcccgaggttccctccccaccaacagcctcgggtctc
tgctggcaagggaacttgcattaccctgtgtacgacggcgccatgttcgt
ccctgaagcaccctccctgcagagctcccaggacaacttcgctgcatctg
ctggtttcaagcgtcgaaggagagagttttgaatacccgaaagaatatag
cgttggacatatctgtcaaacaggggatcttgctgtgggtctcttggtgg
gccaaatcgcatagacaatcattcaaatggatgggttcttcgctggtcgg
tcaaaaagtatatgttgtaattgtacgccttttttgggt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.