Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BQ838550

[Submit comment/correction]

Sequence	BQ838550
Contig	Ta.9622.1.S1_x_at Ta.9622.2.S1_a_at Ta.9622.3.S1_a_at NSFT03P2_Contig14039
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC315467
NCBI UniGene	Ta.29004
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'DEAD-box ATPase-RNA-helicase'
Keyword	EST
Species	Triticum aestivum
Cultivar	BH1146
Clone Library	Wheat aluminum-stressed root tip cDNA library
Tissue	Root tip at 1.0 to 1.5 mm stage
Developmental Stage	Seedling
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	WHE2911_G09_N17ZS Wheat aluminum-stressed root tip cDNA library Triticum aestivum cDNA clone WHE2911_G09_N17, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2911_G09_N17
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20; Seq primer: SK primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions, root tips were excised and snap frozen, total RNA was prepared at University of Missouri(Ross, Gustafson). Poly(A) RNA was purified, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK- phagemids in the TJ Close lab (Chin and Close) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors ). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions, root tips were excised and snap frozen, total RNA was prepared at University of Missouri(Ross, Gustafson). Poly(A) RNA was purified, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript SK- phagemids in the TJ Close lab (Chin and Close) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	cagagatgcgccctttgctgatcacaaggcaaggaacgatccttcttttg agcgcttttcagctggagcaaaccctgcacctgtgccttctactaaccca gctccacaggctgacaatggaaacatgtcggtagatgcataccgtaaaaa gcatgagattactattatttgcccgggacgtgaagctccaccgccattca tgtcgtttcagtccacaggcttcccttcggagattctaagggaggtgcag caagcaggattcaaagcaccaagtcctatccaagctcaatcgtggccgat tgctctaaaaggtagtgatattgtagctgtggcgaagacaggttctggaa aaaccctgggttatctacttccagggtttatacttgttaagaacctacgg cacaattcaagggatgggccaactgtgttagttctgtctccaaccaggga attggcaacacagattcaagatgaagcaatcaagtttggtagatcatcga gaatttcatctacttgtctatatggcggtgctccaaaaggccctcagcta agagatttagagcgtggtgctgacattgttgtcgcaactcctggtagact gaatgatatactagaaatgggaaaagttagtctccgtcaggtagcttatc tcgttcttgatgaagctgaccgcatgcttgatatg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.