Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AJ784895

[Submit comment/correction]

Sequence	AJ784895
Subsequence	AJ784895_1.cds 69 350
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC310647
NCBI UniGene	Ta.56677
Data at Gramene	Gramene-Protein Q5NE34
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Type 2 non-specific lipid transfer protein precursor'
Keyword	ltp72 gene type 2 non-specific lipid transfer protein
Species	Triticum aestivum
Cultivar	Capitole
Tissue	seed
Developmental Stage	4 days after flowering
Data Source	genbank Release 145, Dec 15 2004
Title	Triticum aestivum mRNA for type 2 non-specific lipid transfer protein precursor (ltp7.2 gene).
Clone	pTa176
Gene Product	type 2 non-specific lipid transfer protein
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA' Gene: ltp7.2
EMBL Feature	mat_peptide 147 347 Location: 147..347 polyA_signal 517 522 Location: 517..522 polyA_signal 547 552 Location: 547..552 sig_peptide 69 146 Location: 69..146 feature_gene 1 570 Location: 1..570
DNA	tgcagcacttgccactgcgagagcgagagtgagcaaggagtagaccaaac gtacgtacgacgacggccatgccgatgaggaaggaggtcctgctggtggc catgatgctggcgctggttgtggcggcgccgggcggggcgcgtgccgcgt gcgaggtggggcagctgacggtgtgcatgccggcgatcaccaccggcgcc aagccgagcggcgcgtgctgcggcaacctgcgcgcgcagcaggcgtgctt ctgccagtacgccaaggacccctccctcgctcgctacatcaccagccccc acgcccgcgagaccctcgtctcgtgcggcctcgccgtcccgcactgctag gctaggcgccagctcgcctagcgcgtatggctcagctataggtaggctac ctccgtcgtccatgagagatgagagagactataatagcttagcctagctg agacctgagagagggcatgctgcgtccatgcacgcacgcatgtttctgtc cgatccatgatgctgcaataaaatgttgggtgatgatcggtgcttgaata aaatgagttttcctacctta

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.