Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AJ784897

[Submit comment/correction]

Sequence	AJ784897
Subsequence	AJ784897_1.cds 16 405
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC306043
NCBI UniGene	Ta.55038
Data at Gramene	Gramene-Protein Q5NE32
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Type 1 non-specific lipid transfer protein precursor'
Keyword	ltp96 gene type 1 non-specific lipid transfer protein
Species	Triticum aestivum
Cultivar	Capitole
Tissue	seed
Developmental Stage	4 days after flowering
Data Source	genbank Release 145, Dec 15 2004
Title	Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.6 gene).
Clone	pTa360
Gene Product	type 1 non-specific lipid transfer protein
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA' Gene: ltp9.6
EMBL Feature	mat_peptide 124 402 Location: 124..402 polyA_signal 500 505 Location: 500..505 polyA_signal 556 561 Location: 556..561 sig_peptide 16 123 Location: 16..123 feature_gene 1 589 Location: 1..589
DNA	gtagagtacagcacaatggcgcctagcactcgtagggtcaatgccatcct cgtcgtggggctgctcctcgcggctgccatggcagcggtggcggccgacg cagcggaggccgaggcggcggctgaggtgtcgtgcggggacgcggtgagc gcgctgatcccgtgcgggtcgttcctggtgggcgccgtcgccggggcgcc gagcgagagctgctgccgcggcgcgcaggggctgcggaggatggcgggca cgccgggcgcgcggcgcgcgctctgcaggtgcctggagcagtccggccca tccttcggcgtgctcccggaccgcgcccggcagctacccgcgctctgcaa gctcggcatctccatccccgtcagcccccacaccgactgcgacaagatac agtgagcgaccgatcggcgggcgaactgatggtccgacgcgtgcatgcgg gtggcgtgaagtgatggcacgaagtgttcgatggaggagttcatggctga ataaatagtactgtagctacgatacctgtatttcgcctgccctgctacta ctgtagtcatgggtgaataatggattggtctccactatt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.