Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AJ784898

[Submit comment/correction]

Sequence	AJ784898
Subsequence	AJ784898_1.cds 78 440
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC284661
NCBI UniGene	Ta.54309
Data at Gramene	Gramene-Protein Q5NE31
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Type 1 non-specific lipid transfer protein precursor'
Keyword	ltp97 gene type 1 non-specific lipid transfer protein
Species	Triticum aestivum
Cultivar	Capitole
Tissue	seed
Developmental Stage	4 days after flowering
Data Source	genbank Release 145, Dec 15 2004
Title	Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.7 gene).
Clone	pTa232
Gene Product	type 1 non-specific lipid transfer protein
Remark	DB_xref: taxon:4565 Feature: polyA_site: gene = 'ltp9.7' Feature: source: mol_type = 'mRNA' Gene: ltp9.7
EMBL Feature	mat_peptide 162 437 Location: 162..437 polyA_signal 512 517 Location: 512..517 polyA_site 728 728 Location: 728 sig_peptide 78 161 Location: 78..161 feature_gene 1 728 Location: 1..728
DNA	caagccagcggcactcacactacactcatccactcacaagctaatctagc ggcgtagctcacttcagtccagtcggcatggcggctccgaggggcgcggc actggtgctggcgatggtgctcgcggcgatgctggtggcgccgccggcga cggtgcacgccatatcctgctccacggtgtacagcacgctgatgccgtgc ccgcagtacgtgcagcagggcgggtcgccggcccggggctgctgcaccgg catccagaacctgctggccgaggccaacaacagccccgaccgccgcacca tctgcggctgcctgaagaacgtcgccaacggcgcctccggcgggccctac atcacccgcgccgccgcgctcccctccaagtgcaacgtcgccctccccta caagatcagccccagcgtcgactgcaactcgatccactgaacgaactgaa gcgccctggcccgtgtgtccgtcgacgtacgtctgccgtgtgaggagtcc catgtctggagaataaattgctgctactagtactgaagcttagctaggcc ttggcggccagatccgtgtcgttctacctagtcgttgtgtgtggtttagg gtcgatcgagttaattatccgcatgcagttcatggtgttgtggcctgggt gccggtaggttccacgagcagagcagagtggtgaactgatattgtgtgcg tcgtactacgttcgtgtctatgtaatgt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.