Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AL450631

[Submit comment/correction]

Sequence	AL450631
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC162833
NCBI UniGene	Hv.7799
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Transcribed locus, weakly similar to NP_001061776.1 Os08g0407600 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	barke
Clone Library	Hordeum vulgare Barke etiolated leaves
Tissue	etiolated leaves
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	AL450631 Hordeum vulgare Barke etiolated leaves Hordeum vulgare subsp. vulgare cDNA clone HK03I09u 5', mRNA sequence.
Strain	lab_host XL1Blue vulgare
Clone	HK03I09u
Probe	GBR114
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Michalek W; Institute for Plant Genetics and Crop Plant Research; Corrensstr.3, D-06466 Gatersleben, Germany; Email: michalek@ipk-gatersleben.de, http: Note: Vector: pBluescript SK-; Site_1: SalI; Site_2: NotI ; mRNA was made from etiolated leaves of spring barley variety 'Barke', a high quality malting variety. Plants were grown on filterpaper for 6 d at 25 C in the dark. Leaves were harvested at daylight conditions. Sal-Adaptor Sequence: TCGACCCACGCGTCCG Average insert size is 1 kb Sequence trimming: Vector sequences and sequence ends were trimmed from the 5'-and 3'-end until a 50 bp window contains less than two ambiguities. The maximum length was set to 700 bp. Note: Vector: pBluescript SK-; Site_1: SalI; Site_2: NotI; mRNA was made from etiolated leaves of spring barley variety 'Barke', a high quality malting variety. Plants were grown on filterpaper for 6 d at 25 C in the dark. Leaves were harvested at daylight conditions. Sal-Adaptor Sequence: TCGACCCACGCGTCCG Average insert size is 1 kb Sequence trimming: Vector sequences and sequence ends were trimmed from the 5'-and 3'-end until a 50 bp window contains less than two ambiguities. The maximum length was set to 700 bp.
DNA	gattcccaccctcttcttcctctcgtctcctcctctccacacgcgcacgg acgcacttccatggccgccgcctcctcctcgtcccctcctctcagccccg cttcctcgcgctttttacggactatgcgagcgtgcgtgtgctagggtgga tcgtgcacacggaggcgttttgttggtgaagggaggagctagctaggctg tggtgtggggtggagcttgctggggtatggcctgcaagaacgcgatgagg agaacgacgagcttgacggaggtcgcgccgccgtccgtgctggcggtggt gttggaggacgaggacgaggacgagcaggccaggactgtggtgcaggccg aagaaggtggcgccgacggggggcaggactggctggcggccctaggcggc ggcagcggtgcccccgggacggactggctcgcggcgtaccgcgcgcgcgc ggcgccggcgcgggcggggctccggcggaactcggccgactactccaagg tcgagaccgctgcgttcctccgccactgcggcctctgccgccgcctcctc ggccccggccgcgacaccttcatgtacaagggcgaagcggccttctgcaa cctcgaagtgcccggcagcagcacataacgcacgagggagtgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.