Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AL501374

[Submit comment/correction]

Sequence	AL501374
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC154947
NCBI UniGene	Hv.20467
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Lipoxygenase (LoxB)'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	barke
Clone Library	Hordeum vulgare Barke roots
Tissue	roots
Data Source	genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title	AL501374 Hordeum vulgare Barke roots Hordeum vulgare subsp. vulgare cDNA clone HW03P17u 3', mRNA sequence.
Strain	lab_host XLOLR vulgare
Clone	HW03P17u
Probe	GBR1170
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Michalek W; Institute for Plant Genetics and Crop Plant Research; Corrensstr.3, D-06466 Gatersleben, Germany; Email: michalek@ipk-gatersleben.de, http: Note: Vector: plasmid pBK-CMV; Site_1: EcoRI; Site_2: XhoI; mRNA was made from roots of spring barley variety 'Barke', a high quality malting variety. Roots were grown for two days on filter paper at room temperature Cloning sites: EcoRI (5'-end of cDNA) and XhoI (3'-end of cDNA). NOTE: Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRI adapter. Average insert size is 1 kb Sequence trimming: Vector sequences and sequence ends were trimmed from the 5'-and 3'-end until a 50 bp window contains less than two ambiguities. The maximum length was set to 700 bp
DNA	ttttttttttttttttttggagatgaaaagaatgcgcacacgagtgctta ttcatgcctcattgtcctcaccctatcaacatcatctacgacacaatcat cattttccatcatccactaatccctggcaactaattaccgcaaccaccca gaagccaatgaaaagtaacacaatacaccttgcgagacacgaaccgatcc atgaccagcggacggacgactaccgaaagaaggaaacaaagaccatgctc agctcagatggagacgctgttggggatgcccatggcggtgagccccagcg ccttctccccgttggcgtccgacgtgttggggtacagcagcatgtagggc atcttcacgggcccgttccggttcttgagcgccgggtccttgttcatgtc gaggatccgcttctcgatctccaccagccggctgccgaacctcttgaacg cctcgagcgccttgggcgtccgacgtccactccggcgtgtcgcgctgccc caggtacacctcgtcgggaggagtgcttggacaaggatctcgaangagcg tgatgcccggaggaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.