Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CB876579

[Submit comment/correction]

Sequence	CB876579
External Databases	Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene	Hv.11985
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Transcribed locus'
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	barke
Clone Library	HX
Tissue	apex
Developmental Stage	apex (3-5 mm in size)
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	HX11L11w HX Hordeum vulgare subsp. vulgare cDNA clone HX11L11 3-PRIME, mRNA sequence.
Strain	lab_host XL10-Gold vulgare
Clone	HX11L11
Probe	UMB705 UMB707
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Stein Nils; Molecular Markers Group, Department Genbank; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, 06466, Gatersleben, Germany; Tel: 039482-5522; Fax: 039482-5595; Email: stein@ipk-gatersleben.de; Insert Length: 565 Std Error: 0.00; Plate: 11 row: L column: 11; Seq primer: T7. Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable.
DNA	gcatcaacttgaaccaagtaccatatcaaaaagtggaaactggaccagag ttagtgagaggaatttgctgagacacacacacacctgaactgaatcagat tagcaggtcaaagagagagagagagagagagaggtggacatgaacttcac ctcaaggctgatggggaagaacgccgactcctacagcttttcgtgcatcg tgcttgtcatatatatatatatatatatatatatatatatatatatatat atatatatatatatatatatactaataaaagtgcccgtgcgttgcaccag gttagattgtcgattttcggatcatgaattttgtatttgaatcccctccc ctcatgtccttcgtcgtccccctgtgaaggactataccagcgagcaccgg caccagccctctgccgcctcctcaagtgtctcgccatccctcagtgaagg cttcgtccctcgccaccgccgcaactcctccatgcccccacgggcggtgc actacggcgatcgggatgccgctagagggctccggcaccagccctttgcc gcctcgccgtccctc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.